View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_26 (Length: 249)
Name: NF18960_low_26
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 2 - 242
Target Start/End: Complemental strand, 7679085 - 7678855
Alignment:
| Q |
2 |
tctagattactaaattaatgcatgcgctgattgcttgttagacaagttttttactctttagacatgattttgtacgatttgaatacaaactaattattat |
101 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
7679085 |
tctagatcactaaattaatgcatgcgctgattgcttgttagacaaattttttactctttagacatggttttgtacgatttaaatacaaactaattattat |
7678986 |
T |
|
| Q |
102 |
tattattagatgaaaaaattagcccacatcatcagctatgtgtgagacagacaatacaagaagggagattattattactgtaacaatgacaaacaatgct |
201 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
7678985 |
ta------gatgaaaaaattagcccgcatcatcagctatgtgtgagaca----atacaagaagggagattaatattactgtaacaatgaccaacaatgct |
7678896 |
T |
|
| Q |
202 |
tccccagtatgagggaaaatgttcttgactagtttcatttc |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7678895 |
tccccagtatgagggacaatgttcttgactagtttcgtttc |
7678855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University