View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_27 (Length: 241)
Name: NF18960_low_27
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 45698125 - 45697912
Alignment:
| Q |
8 |
ttgccattatgctcaactctagtgttgcatctcattagtgggggtaacttttaataaccgtttgttttgtgctaaatagagttttactaagtttacggac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45698125 |
ttgccattatgctcaactctagtgttgcatctcattagtgggggtaacttttaataaccgtttgttttgtgctaaatagagttttacgaagtttacggac |
45698026 |
T |
 |
| Q |
108 |
aaaatttctccctatgaaattttgaagtaaaacataattgaacttgtgttattttcaaacttgtggttgtctagcttgactcatctttgaccccagagag |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45698025 |
aaaatttttccctatgaaattttgaagtaaaacataattgaacttgtgttattttcaaacttgtggttgtctagcttgactcatctttgaccccagagag |
45697926 |
T |
 |
| Q |
208 |
ttaaacacgacaat |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45697925 |
ttaaacacgacaat |
45697912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 89
Target Start/End: Complemental strand, 4057599 - 4057543
Alignment:
| Q |
33 |
tgcatctcattagtgggggt-aacttttaataaccgtttgttttgtgctaaatagagt |
89 |
Q |
| |
|
||||||||||| |||||||| || ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
4057599 |
tgcatctcatt-gtgggggttaaattttattaatcgtttgttttgtgctaaatagagt |
4057543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University