View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_28 (Length: 240)
Name: NF18960_low_28
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 30 - 224
Target Start/End: Original strand, 7679342 - 7679536
Alignment:
| Q |
30 |
taatcatacttgtccacatcgctatccgccacttctaaatgccaagaacttgactcccccaaaaaataaattaattgcataaaccctttaattgcatctt |
129 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7679342 |
taatcatactcgtccacatcgctatccgccactcctaattgccaagaacttgactgccccaaaaaataaattaattgcataaaccctttaattgcatctt |
7679441 |
T |
 |
| Q |
130 |
tacaatttcaaaataaattaattgccccaaaaatgttttaacattggtacataaagatagtccataacagaaagcaacaaaaattaccttcatct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7679442 |
tacaatttcaaaataaattaattgccccaaaaatgttttaacattggtacataaagatagtccataacataaagcaacaaaaattaccttcatct |
7679536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 43003166 - 43003222
Alignment:
| Q |
1 |
tccttcatgataccacatgccatcatcat--taatcatacttgtccacatcgctatc |
55 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
43003166 |
tccttcataaaaccacatgccatcatcattgtaattatactcgtccacatcgctatc |
43003222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University