View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18960_low_29 (Length: 227)
Name: NF18960_low_29
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18960_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 22982604 - 22982708
Alignment:
| Q |
20 |
ttctacgcgataatgaggtgaactactatttttcttgaagattatgcgataatgaatttgcaagatgttttaacatgttttccacattgttactgatagg |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22982604 |
ttctacgcgataatgaggtgaacttctatttttcttgaagattatgcgataatgaatttgcaagatgttttaacatgttttccacattgttactgatagg |
22982703 |
T |
|
| Q |
120 |
ctcaa |
124 |
Q |
| |
|
||||| |
|
|
| T |
22982704 |
ctcaa |
22982708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 131
Target Start/End: Original strand, 38397982 - 38398022
Alignment:
| Q |
91 |
aacatgttttccacattgttactgataggctcaattttgcg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38397982 |
aacatgttttccacattgttactgataggctcaattatgcg |
38398022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University