View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18960_low_29 (Length: 227)

Name: NF18960_low_29
Description: NF18960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18960_low_29
NF18960_low_29
[»] chr2 (1 HSPs)
chr2 (20-124)||(22982604-22982708)
[»] chr8 (1 HSPs)
chr8 (91-131)||(38397982-38398022)


Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 22982604 - 22982708
Alignment:
20 ttctacgcgataatgaggtgaactactatttttcttgaagattatgcgataatgaatttgcaagatgttttaacatgttttccacattgttactgatagg 119  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22982604 ttctacgcgataatgaggtgaacttctatttttcttgaagattatgcgataatgaatttgcaagatgttttaacatgttttccacattgttactgatagg 22982703  T
120 ctcaa 124  Q
    |||||    
22982704 ctcaa 22982708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 131
Target Start/End: Original strand, 38397982 - 38398022
Alignment:
91 aacatgttttccacattgttactgataggctcaattttgcg 131  Q
    |||||||||||||||||||||||||||||||||||| ||||    
38397982 aacatgttttccacattgttactgataggctcaattatgcg 38398022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University