View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18961_high_10 (Length: 242)
Name: NF18961_high_10
Description: NF18961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18961_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 31577122 - 31576905
Alignment:
| Q |
16 |
cacactattcttgcaaagtttttac-accaagctagtctcaattctcaaatatttgacttaacagttatcaccgaattctattactggtattctttaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31577122 |
cacactattcttgcaaagtttttaccaccaagctagtctcaattctcaaatatttgacttaacagttatcaccgaattctattactggtattctttaaaa |
31577023 |
T |
 |
| Q |
115 |
acaaatatggtgacatatgaaatatttgagggtcttatttggtgattaaagctttttggaaaattaatttggtgacannnnnnnnaccatcactcttact |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
31577022 |
agaaatatggtgacatatgaaatatttgagggtcttatttggtgattaaagctttttggaaaactaatttggtgacattttttttaccatcactcttact |
31576923 |
T |
 |
| Q |
215 |
taagaggtgttgcctttg |
232 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
31576922 |
taagaggtgttggctttg |
31576905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University