View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18961_high_5 (Length: 335)
Name: NF18961_high_5
Description: NF18961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18961_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 3e-88; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 15427459 - 15427267
Alignment:
| Q |
11 |
catcagtttcatataagctttcctgcaaaggaatattgaaaatacataaccaaatgagaaaaattcaacatgtgcataagttgccacacaaaaaacatgc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427459 |
catcagtttcatataagctttcctgcaaaggaatattgaaaatacataaccaaatgagaaaaattcaacatgtgcataagttgccacacaaaaaacatgt |
15427360 |
T |
|
| Q |
111 |
atataagttgaggtgtcnnnnnnnntgtgcataattaagatgaagaataaaagtatgttataaagaaaatgaccttgttataattgggttcaa |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427359 |
atataagttgaggtgtcaaaaaaaatgtgcataattaagatgaagaataaaagtatgttataaagaaaatgaccttgttataattgggttcaa |
15427267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 269 - 329
Target Start/End: Complemental strand, 15427201 - 15427140
Alignment:
| Q |
269 |
aaagatctgatccatggttggaagtt-agtcccagtggatttagaggtagttggtgatgatg |
329 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15427201 |
aaagatctgatccatggttggaagtttagtcccagtggatttagaggtagttggtgatgatg |
15427140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 15436622 - 15436570
Alignment:
| Q |
269 |
aaagatctgatccatggttggaagtt-agtcccagtggatttagaggtagttg |
320 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
15436622 |
aaagatctgccccatggttggatgtttagtcccagttgatttagaggtagttg |
15436570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University