View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18961_low_5 (Length: 397)
Name: NF18961_low_5
Description: NF18961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18961_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 141 - 390
Target Start/End: Complemental strand, 5451455 - 5451207
Alignment:
| Q |
141 |
attttatagctaatgctaatatatttattcagttgtataatatttgcacacaaatttaagaataaattacatgattgtggtctcgtataacatttgatct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5451455 |
attttatagctaatgctaatatatttattcagttgtataatatttgcacacaaatttaagaataaattacatgattgtggtctcgtataacatttgatct |
5451356 |
T |
|
| Q |
241 |
ctggagtaacaaatacattgattggttaatggagttgcaacatctccaaagaaattggtaccttactcactgatttgtccgggaatcaaagagatagcat |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5451355 |
ctggagtaacaaatacattg-ttggttaatggagttgcaacatctccaaagaaattggtaacttactcactgatttgtccgggaatcaaagagatagcat |
5451257 |
T |
|
| Q |
341 |
ggaacaatgagggattaatgattcggtaccacaagaggaacattcatctc |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5451256 |
ggaacaatgagggattaatgattcggtaccacaagaggaacatttatctc |
5451207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 15 - 86
Target Start/End: Complemental strand, 5451583 - 5451510
Alignment:
| Q |
15 |
attatattcgggcatgcaactacagttagatgccccactgcaactcgtgtgatacgaaac--ttgcatcagtag |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5451583 |
attatattcgggcatgcaactacagttagatgccccactgcaactcgtgtgatacgaaactgttgcatcagtag |
5451510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University