View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18962_low_12 (Length: 296)
Name: NF18962_low_12
Description: NF18962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18962_low_12 |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 23 - 283
Target Start/End: Complemental strand, 18321 - 18068
Alignment:
| Q |
23 |
aaagagaagcatttattaagcatctattta-ctgtgagtttgaaaccgcatgacgttgccgtggctttctaccgcacgtttgatcaacttgacccggatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18321 |
aaagagaagcatttattaagcatctatttagctgtgagtttgaaactgcatgacgttgccgtggctttctaccgcacgtttgatcaacttgacccggatt |
18222 |
T |
 |
| Q |
122 |
catataaaatcaaatatccgtgactataacattactctctggtgtttaaatcctagagcgtgtctctgtaacagcacagtctaaatccgttgtgtctgaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
18221 |
catataaaatcaaatatccgtgactataacattactcgctagtgtttaaatcctagagcgtgtctcgg--------cagtctaaatccgttgtgtctgaa |
18130 |
T |
 |
| Q |
222 |
atatctgaagttgtggcaattgggcaattttttgattcatagtctgaggagggggtctgtct |
283 |
Q |
| |
|
||||| ||||||| |||| || |||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18129 |
atatccgaagttgcggcagtttggcagttttttgattcatagtctgaggagggggtgtgtct |
18068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 212 - 286
Target Start/End: Original strand, 7425592 - 7425666
Alignment:
| Q |
212 |
tgtgtctgaaatatctgaagttgtggcaattgggcaattttttgattcatagtctgaggagggggtctgtctgtg |
286 |
Q |
| |
|
||||||||||||||| ||||| |||||| | | ||| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
7425592 |
tgtgtctgaaatatccgaagtcgtggcagattgacaaattgttgattcatagtctgaggtgggggtctgtctgtg |
7425666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University