View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18962_low_15 (Length: 227)
Name: NF18962_low_15
Description: NF18962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18962_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 51231518 - 51231715
Alignment:
| Q |
14 |
agaataatataaacaattaacgtttacgagatttatacagggacttatatgatttgatcgggtgtgatttgatgagattcataaaagtttt-aatctata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
51231518 |
agaataatataaacaattaacgtttacgagatttatatagggacttatatgatttgatcgggtgtgatttgatgagattcatagaagtttttaatctata |
51231617 |
T |
|
| Q |
113 |
aaatagagtatattgatgtttggtgttaggaaatgccatgccaacccttctctaagggtctttgtggtacggttttaaggctaaaatacaatcgaact |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51231618 |
aaatagagtatattgatgattggtgttaggaaatgccatgccaacccttctctaagggtctttgtggtacggttttaaggctaaaatacaatcgaact |
51231715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University