View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_high_26 (Length: 307)
Name: NF18963_high_26
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 168 - 294
Target Start/End: Original strand, 38929079 - 38929200
Alignment:
| Q |
168 |
tttgctaacgttcatttttgtagttttgagttttgagatgtcttggtgaattggtttatgtcagtttgaacgttacacttgcagagtagtgttgagttta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929079 |
tttgctaacgttcatttttgtagttttgagttttgagatgtcttggtgaattggtttatgtcagtttgaacgttacacttgcagagtagtgttgag---- |
38929174 |
T |
|
| Q |
268 |
ctttactttcttgaaacacgtgaatat |
294 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38929175 |
-tttactttcttgaaacacgtgaatat |
38929200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 38928906 - 38928968
Alignment:
| Q |
17 |
catgttcctctgtttcttgtgtagaggaagcctggcaaatggggtgaagcttgagctgattgg |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38928906 |
catgttcctctgtttcttgtgtagaggaagcctggcaaatggggtgaagcttgagctgattgg |
38928968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 135 - 171
Target Start/End: Original strand, 38929024 - 38929060
Alignment:
| Q |
135 |
ccatagttgttgtcgtgttcttcttcatttgattttg |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929024 |
ccatagttgttgtcgtgttcttcttcatttgattttg |
38929060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University