View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_high_29 (Length: 270)
Name: NF18963_high_29
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 45705523 - 45705710
Alignment:
| Q |
18 |
gattcaaggaagggtgaaaagaggaaaatgatgcggctaaatcagtgctatagagcaaatcagagtgtttgcaattgacatacgaagttgta-------- |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45705523 |
gattcaaggaagggtgaaaagaggaaaatgatgcggctaaatcagtgctatagagcaaatcagagtgtttgcaattgacatacgaagttgtatcagatag |
45705622 |
T |
 |
| Q |
110 |
ggaacacgttaggctaagttaggggtagtggatgacgtacacacgattggaactggtttaccagaagcttctcagaagataacgatac |
197 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45705623 |
ggaaaacgttaggctaagtaaggggtagtggatgacgtacacacgattggaactggtttaccagaagcttctcagaagataacgatac |
45705710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University