View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18963_high_29 (Length: 270)

Name: NF18963_high_29
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18963_high_29
NF18963_high_29
[»] chr1 (1 HSPs)
chr1 (18-197)||(45705523-45705710)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 45705523 - 45705710
Alignment:
18 gattcaaggaagggtgaaaagaggaaaatgatgcggctaaatcagtgctatagagcaaatcagagtgtttgcaattgacatacgaagttgta-------- 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            
45705523 gattcaaggaagggtgaaaagaggaaaatgatgcggctaaatcagtgctatagagcaaatcagagtgtttgcaattgacatacgaagttgtatcagatag 45705622  T
110 ggaacacgttaggctaagttaggggtagtggatgacgtacacacgattggaactggtttaccagaagcttctcagaagataacgatac 197  Q
    |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45705623 ggaaaacgttaggctaagtaaggggtagtggatgacgtacacacgattggaactggtttaccagaagcttctcagaagataacgatac 45705710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University