View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_high_47 (Length: 217)
Name: NF18963_high_47
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_high_47 |
 |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0079 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 47850 - 47669
Alignment:
| Q |
17 |
cagagaaaacaggaaaggtgatcattgtggatcatgtattggacccagaaggaaacgaaccatttaccgacactgggatagcatttgacatgatgttgct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47850 |
cagagaaaacaggaaaggtgatcattgtggatcatgtattggacccagaaggaaatgaaccatttaccgacactgggatagcatttgacatgatgttgct |
47751 |
T |
 |
| Q |
117 |
tgctcacaatgctggtggtaaagaaagaactgaagagaactggaaatacctattcaacgagacaggattccctcgttacaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47750 |
tgctcacaatgctggtggtaaagaaagaactgaagagaactggaaatacctattcaacgagacaggattccctcgttacaac |
47669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 16345011 - 16345192
Alignment:
| Q |
17 |
cagagaaaacaggaaaggtgatcattgtggatcatgtattggacccagaaggaaacgaaccatttaccgacactgggatagcatttgacatgatgttgct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16345011 |
cagagaaaacaggaaaggtgatcattgtggatcatgtattggacccagaaggaaatgaaccatttaccgacactgggatagcatttgacatgatgttgct |
16345110 |
T |
 |
| Q |
117 |
tgctcacaatgctggtggtaaagaaagaactgaagagaactggaaatacctattcaacgagacaggattccctcgttacaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16345111 |
tgctcacaatgctggtggtaaagaaagaactgaagagaactggaaatacctattcaacgagacaggattccctcgttacaac |
16345192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 36190 - 36369
Alignment:
| Q |
19 |
gagaaaacaggaaaggtgatcattgtggatcatgtattggacccagaaggaaacgaaccatttaccgacactgggatagcatttgacatgatgttgcttg |
118 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||||||||||| | ||||||||||| || | ||| ||||||||||||||||| ||| ||| |
|
|
| T |
36190 |
gagaaaactggaaaggtgataatattggatcatgtattggacccagaaggagatgaaccatttactgatattggcatagcatttgacatgatattgtttg |
36289 |
T |
 |
| Q |
119 |
ctcacaatgctggtggtaaagaaagaactgaagagaactggaaatacctattcaacgagacaggattccctcgttacaac |
198 |
Q |
| |
|
| ||||| |||||||||| ||||| ||||||||||||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
36290 |
cacacaactctggtggtaaggaaaggactgaagagaactggaaatacttattcaaagagacgggattccctcgttacaac |
36369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University