View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_high_49 (Length: 215)
Name: NF18963_high_49
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 47426689 - 47426508
Alignment:
| Q |
17 |
cagagaaacaagtctatagaatttgcttctttgaagcaaaatatgttgtcaaactcagcacgctatgatcattgggttgttaattcaatgaaggagagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47426689 |
cagagaaacaagtctatagaatttgcttctttgaagcaaaatatgttgtcaaactcagcacgctatgatcattgggttgttaattcaatgaaggagagta |
47426590 |
T |
 |
| Q |
117 |
agcatgattcctttggtagctatgcggttactactagtgatgattcctattattactcgtgaattcttgaatggtacaaagt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47426589 |
agcatgattcctttggtagctatgcggttactactagtgatgattcctattattactcgtgaattcttgaatggtacaaagt |
47426508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University