View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_high_51 (Length: 212)
Name: NF18963_high_51
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 31221621 - 31221793
Alignment:
| Q |
16 |
aatattcagcacatgtgacatgactacatgagtgactcaaatagtaggtactcacaacctatgaagcactaatagtgacacatacacgtgaacaccggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31221621 |
aatattcagcacatgtgacatgactacatgagtgactcaaatagtaggtactcacagcctatgaagcactaatagtgatacatacacgtgaacaccggta |
31221720 |
T |
 |
| Q |
116 |
ataatttgaaataatagattaatttaaggtaatcacattgtgtcggtgttgtgtcggacatgtcatccatcat |
188 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
31221721 |
ataatttggaataatagattaatttaacgtaatcacattgtgtcagtgttgtgtcggatatgtcatccatcat |
31221793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 156
Target Start/End: Complemental strand, 5461222 - 5461178
Alignment:
| Q |
112 |
ggtaataatttgaaataatagattaatttaaggtaatcacattgt |
156 |
Q |
| |
|
||||||||||||| |||||| ||||||| || ||||||||||||| |
|
|
| T |
5461222 |
ggtaataatttgagataataaattaattgaatgtaatcacattgt |
5461178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University