View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_high_54 (Length: 201)
Name: NF18963_high_54
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_high_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 18 - 135
Target Start/End: Complemental strand, 45691434 - 45691317
Alignment:
| Q |
18 |
agtttcctcctatttatttaaccagcatggtacaaaaacaattcagcataataatgcatcctctaactggaattaattaacgtctcagtgggtttagggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45691434 |
agtttcctcctatttatttaaccagcatggtacaaaaacaattcagcataataatgcatcctctaactggaattaattaacgtctcaatgggtttagggt |
45691335 |
T |
|
| Q |
118 |
tgtgattattgatgccat |
135 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45691334 |
tgtgattattgatgccat |
45691317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University