View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18963_low_27 (Length: 307)

Name: NF18963_low_27
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18963_low_27
NF18963_low_27
[»] chr7 (3 HSPs)
chr7 (168-294)||(38929079-38929200)
chr7 (17-79)||(38928906-38928968)
chr7 (135-171)||(38929024-38929060)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 168 - 294
Target Start/End: Original strand, 38929079 - 38929200
Alignment:
168 tttgctaacgttcatttttgtagttttgagttttgagatgtcttggtgaattggtttatgtcagtttgaacgttacacttgcagagtagtgttgagttta 267  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
38929079 tttgctaacgttcatttttgtagttttgagttttgagatgtcttggtgaattggtttatgtcagtttgaacgttacacttgcagagtagtgttgag---- 38929174  T
268 ctttactttcttgaaacacgtgaatat 294  Q
     ||||||||||||||||||||||||||    
38929175 -tttactttcttgaaacacgtgaatat 38929200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 38928906 - 38928968
Alignment:
17 catgttcctctgtttcttgtgtagaggaagcctggcaaatggggtgaagcttgagctgattgg 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38928906 catgttcctctgtttcttgtgtagaggaagcctggcaaatggggtgaagcttgagctgattgg 38928968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 135 - 171
Target Start/End: Original strand, 38929024 - 38929060
Alignment:
135 ccatagttgttgtcgtgttcttcttcatttgattttg 171  Q
    |||||||||||||||||||||||||||||||||||||    
38929024 ccatagttgttgtcgtgttcttcttcatttgattttg 38929060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University