View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_low_29 (Length: 286)
Name: NF18963_low_29
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 4 - 269
Target Start/End: Complemental strand, 41836661 - 41836396
Alignment:
| Q |
4 |
tagtattaatgttgtcaccactcctcatgtactatctgtacctgagaggctgtgattgatttcctcgcgtgtaatgcagaatgttcagattggcaagttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41836661 |
tagtattaatgttgtcaccactcctcatgtaccatctgtgcctgagaggctgtgattgatttcctcgcttgtaatgcagaatgttcagattggcaagttg |
41836562 |
T |
 |
| Q |
104 |
tacttcaattattatgaacgaaggacaccataaacataaaggcacaaacaaatcacaataatgtacaatatcatttatttattgcttcattcattggatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41836561 |
tacttcaattattatgaacgaaggacaccataaacataaaggcacaaacaaatcacaataatgtacagtatcatttatttattgcttcattcattggatt |
41836462 |
T |
 |
| Q |
204 |
caaatgctggcccccgtcacccaggcaaaagacaccgcctttacgcactgtacacagcacacattg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41836461 |
caaatgctggcccccgtcacccaggcaaaagacaccgcctttacgcgctgtacacagcacacattg |
41836396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University