View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_low_30 (Length: 280)
Name: NF18963_low_30
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 134 - 266
Target Start/End: Original strand, 7542990 - 7543122
Alignment:
| Q |
134 |
aaaaaattaagctgaggatttaatatgtctattttgtgtgaagatctaaagaaattacgtactacttatgcattaatgtgtctgaattaatagttttgat |
233 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542990 |
aaaaaattaagctgtggatttaatatgtctattttgtgtgaagatctaaagaaattacgtactacttatgcattaatgtgtctgaattaatagttttgat |
7543089 |
T |
|
| Q |
234 |
ttgcttttgacaactacatcgattgaaagtagt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7543090 |
ttgcttttgacaactacatcgattgaaagtagt |
7543122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 7542741 - 7542858
Alignment:
| Q |
1 |
ttgtttttgttattctcttgttagagaagcatataattaaggaatattatcttcacatatcatacttctctaacaagatatgtgtaattaaaaaggatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542741 |
ttgtttttgttattctcttgttagagaagcatataa----ggaatattatcttcacatatcatacttctctaacaagatatgtgtaattaaaaaggatag |
7542836 |
T |
|
| Q |
101 |
caattgtatgatatgtgaagat |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7542837 |
caattgtatgatatgtgaagat |
7542858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University