View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_low_39 (Length: 250)
Name: NF18963_low_39
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 25897138 - 25896909
Alignment:
| Q |
1 |
gtgtgccatagccagagtactttgattatcacagtataaggggggaagcaataggaacttgaagctcttgtagaagagtcttaacctaaaggatttctgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
25897138 |
gtgtgccatagccagagtactttgattatcacagtataaggggggaagcaataggaacttgaagctcttgtaggagagtcttaac-taaaggatttctgc |
25897040 |
T |
 |
| Q |
101 |
agtgattagagcaaggctacggtattatacttttgcactagaacgagccacaacagattgttttctggaccaccaggatataagatttggaccaaaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25897039 |
agtgattagagcaaggctacggtactatacttttgcactagaacgagccacaacagattgttttctggaccaccaggatataagatttgaaccaaaaaac |
25896940 |
T |
 |
| Q |
201 |
aaagcagctccagaggtggaacgacggtcat |
231 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
25896939 |
aaagcagctccagaggaggaacgacggtcat |
25896909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 6869548 - 6869604
Alignment:
| Q |
158 |
ttgttttctggaccaccaggatataagatttggaccaaaaaacaaagcagctccaga |
214 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||| || | |||||| ||||| |
|
|
| T |
6869548 |
ttgttttctagaccacaaggagataagatttggaccaaagaaaatagcagcaccaga |
6869604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 39582614 - 39582558
Alignment:
| Q |
158 |
ttgttttctggaccaccaggatataagatttggaccaaaaaacaaagcagctccaga |
214 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||| || | |||||| ||||| |
|
|
| T |
39582614 |
ttgttttctagaccacaaggagataagatttggaccaaagaaaatagcagcaccaga |
39582558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University