View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_low_45 (Length: 239)
Name: NF18963_low_45
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 24564928 - 24565151
Alignment:
| Q |
1 |
gtttaaaacattcacacattatacatcaaccactgtaaatattgatggtaggaaacactactaaggatctgtttgttcaaacaaagtagataggtcagct |
100 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24564928 |
gtttacaacattcacacactatacatcaaccactgtaaataatgatggtaggaaacattactaaggatctgtttggtcaaacaaagtagataggtcagct |
24565027 |
T |
 |
| Q |
101 |
agtatgtaaagcatgaatttacaatgataatcggtaagttagttatatagcgaataaactaaccggttgaatatgtcctttttggtaaaattagttatta |
200 |
Q |
| |
|
| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24565028 |
attacgtaaggcatgaatttacaatgataatcggtaagttagttatatagcgaataaactaactggttgaatatgtcctttttggtaaaattagttatta |
24565127 |
T |
 |
| Q |
201 |
taaactgattgat-aatacaaaat |
223 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
24565128 |
taaactgattgataaatacaaaat |
24565151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University