View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_low_47 (Length: 227)
Name: NF18963_low_47
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 10693400 - 10693222
Alignment:
| Q |
1 |
aaaaatagcatatttcgattgatttattgaagaatagttattgacataagtaattattgaattgtttgaaagagcatatgaaaacaacttatgatatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693400 |
aaaaatagcatatttcgattgatttattgaagaatagttattgacataagtaattattgaattgtttgaaagagcatatgaaaacaacttatgatatgtt |
10693301 |
T |
|
| Q |
101 |
tgtaacttattttcaggtaatctctatagggtaacttatgaaaacaatttatagtttatagtttgtatgcaaacatttt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693300 |
tgtaacttattttcaggtaatctctatagggtaacttatgaaaacaatttatagtttatagtttgtatgcaaacatttt |
10693222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 24281148 - 24281112
Alignment:
| Q |
61 |
attgtttgaaagagcatatgaaaacaacttatgatat |
97 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
24281148 |
attgtttgagagagcttatgaaaacaacttatgatat |
24281112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University