View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18963_low_51 (Length: 215)

Name: NF18963_low_51
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18963_low_51
NF18963_low_51
[»] chr5 (1 HSPs)
chr5 (19-178)||(4711195-4711354)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 19 - 178
Target Start/End: Original strand, 4711195 - 4711354
Alignment:
19 atacatcataaactttaattaatccagatggtcatttggttacatgtctattgtccatgacacatgtcatccacccaagtagtgcaaaatcttatcactg 118  Q
    ||||||||| |||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4711195 atacatcatcaactttaattgacctagatggtcatttggttacatgtctattgtccatgacacatgtcatccacccaagtagtgcaaaatcttatcactg 4711294  T
119 gttacgtgtctgtcataaacgtatttctatgaattgcatgcttcttttctgcattttgtc 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4711295 gttacgtgtctgtcataaacgtatttctatgaattgcatgcttcttttctgcattttgtc 4711354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University