View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18963_low_51 (Length: 215)
Name: NF18963_low_51
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18963_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 19 - 178
Target Start/End: Original strand, 4711195 - 4711354
Alignment:
| Q |
19 |
atacatcataaactttaattaatccagatggtcatttggttacatgtctattgtccatgacacatgtcatccacccaagtagtgcaaaatcttatcactg |
118 |
Q |
| |
|
||||||||| |||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711195 |
atacatcatcaactttaattgacctagatggtcatttggttacatgtctattgtccatgacacatgtcatccacccaagtagtgcaaaatcttatcactg |
4711294 |
T |
 |
| Q |
119 |
gttacgtgtctgtcataaacgtatttctatgaattgcatgcttcttttctgcattttgtc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711295 |
gttacgtgtctgtcataaacgtatttctatgaattgcatgcttcttttctgcattttgtc |
4711354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University