View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18963_low_57 (Length: 207)

Name: NF18963_low_57
Description: NF18963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18963_low_57
NF18963_low_57
[»] chr3 (1 HSPs)
chr3 (1-201)||(51209890-51210090)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 51209890 - 51210090
Alignment:
1 gataccattgtccaacggaacattctttgattcaaaaatgtatccaaaggatggaattttggaagctttgcaagctaattacaatgcaacaaaaggtaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51209890 gataccattgtccaacggaacattctttgattcaaaaatgtatccaaaggatggaattttggaagctttgcaagctaattacaatgcaacaaaaggtaat 51209989  T
101 gataagctcatgatttcaaagaattccaaaaagaagccatcgacaatagttacgatatctgagatgaacttaatgttacagcgtaaccatgcttcttctc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
51209990 gataagctcatgatttcaaagaattccaaaaagaagccatcgaaaatagttgcgatatctgagatgaacttaatgttacagcgtaaccatgcttcttctc 51210089  T
201 a 201  Q
    |    
51210090 a 51210090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University