View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18964_high_4 (Length: 406)
Name: NF18964_high_4
Description: NF18964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18964_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Complemental strand, 14726631 - 14726241
Alignment:
| Q |
1 |
cttttcttgtagatggtgattgagcgggaagaaatcttataattgcctcttctacgaattgtgttgggatccttgtaagtgcttggagtgatttgggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14726631 |
cttttcttgtagatggtgattgagcgggaagaaatcttataattgcctcttctacgaattgtgttgggatccttgtaagtgcttggagtgatttgggggt |
14726532 |
T |
 |
| Q |
101 |
gggggtgtagaagctgtcagttgttcttgcgttttttggctacggtgttcctgtgtttgtgggtaggtgggagtctttttggtttgcagaggcctagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14726531 |
gggggtgtagaagctgtcagttgttcttgcgttttttggctacggtgttactgtgtttgtgggtaggtgggagtctttttggtttgcagaggcctagttt |
14726432 |
T |
 |
| Q |
201 |
tggttgaatgtgatggttttgtgttggtgtcggatatctgacacgttcagaaatgtcggtactatagagatcagaattgatgcctttctatcatatagtg |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14726431 |
tggttgaatgtgaaggttttgtgttggtgtcggatatctgacacgttcagaaatgtcggtactatagagatcagaattgatgcctttctatcatatagtg |
14726332 |
T |
 |
| Q |
301 |
acgctgggcatgtattggttgtcaaataccgactgctgtcgaatatgatataattgatatggtcctgctgtacgttctttagtataaaatg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14726331 |
acgctgggcatgtattggttgtcaaataccgactgctgtcgaatatgatataattgatatggtcctgctgtacgttctttagtataaaatg |
14726241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 1 - 391
Target Start/End: Original strand, 17596879 - 17597269
Alignment:
| Q |
1 |
cttttcttgtagatggtgattgagcgggaagaaatcttataattgcctcttctacgaattgtgttgggatccttgtaagtgcttggagtgatttgggggt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17596879 |
cttttcttgtagatggcgattgagcgggaagaaatcttataattgcctcctctacggatggtgttgggatccttgtaagtgcttggagtgatttgggggt |
17596978 |
T |
 |
| Q |
101 |
gggggtgtagaagctgtcagttgttcttgcgttttttggctacggtgttcctgtgtttgtgggtaggtgggagtctttttggtttgcagaggcctagttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17596979 |
gggggtgtagaagctgtcagttgttcttgcgttttttggctacggtgtttctgtgtttgtgggtaggtgggagtctttttggtttgcagaggcctagttt |
17597078 |
T |
 |
| Q |
201 |
tggttgaatgtgatggttttgtgttggtgtcggatatctgacacgttcagaaatgtcggtactatagagatcagaattgatgcctttctatcatatagtg |
300 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
17597079 |
tggttgaatgtgacggttttgtgttggtgtcggatatctgacacgttcagaaatgtcggtactatagagatcataattgacgcctttctatcatatagtg |
17597178 |
T |
 |
| Q |
301 |
acgctgggcatgtattggttgtcaaataccgactgctgtcgaatatgatataattgatatggtcctgctgtacgttctttagtataaaatg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17597179 |
acgctgggcatgtattggttgtcaaataccgactgctgtcgaatatgatataattgatatggtcctgttgtacgttatttagtataaaatg |
17597269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University