View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18964_high_7 (Length: 275)
Name: NF18964_high_7
Description: NF18964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18964_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 24 - 252
Target Start/End: Complemental strand, 18407448 - 18407220
Alignment:
| Q |
24 |
atccattgcaatcctggacgacgaacatgcagtacagggctgcatgcaaccatcaaatttcttcttcccaagaatcctcccatacaaaagaaaccgaaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18407448 |
atccattgcaatcctggacgacgaacatgcagtacagggctgcatgcaaccatcaaatttcttcttcccaagaatcctcccatacaaaagaaaccgaaaa |
18407349 |
T |
 |
| Q |
124 |
tcaaaatcagatttcggtctcatggaaggtggccgtcttccagaattaatggcagaaccaactaatgtccgatcaatgtcattcgttggaacacatgagt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18407348 |
tcaaaatcagatttcggtctcatggtaggtggccgtcttccagaattaatggcagaaccaactaatgtccgatcaatgtcattcgttggaacacatgagt |
18407249 |
T |
 |
| Q |
224 |
atcttgctccagaaatcgtgcgtggtgaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18407248 |
atcttgctccagaaatcgtgcgtggtgaa |
18407220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 240
Target Start/End: Complemental strand, 26569591 - 26569511
Alignment:
| Q |
160 |
cttccagaattaatggcagaaccaactaatgtccgatcaatgtcattcgttggaacacatgagtatcttgctccagaaatc |
240 |
Q |
| |
|
||||| ||| |||||||||||||||| ||||| ||||||||||||| || || ||||| |||||||| || || |||||| |
|
|
| T |
26569591 |
cttcctgaactaatggcagaaccaaccaatgtaagatcaatgtcatttgtaggcacacacgagtatctcgcacctgaaatc |
26569511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University