View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18964_high_9 (Length: 218)
Name: NF18964_high_9
Description: NF18964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18964_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 52767002 - 52767188
Alignment:
| Q |
15 |
cacagaggaattaaagctaaaaccataa-gcatcgagtctttctcaagctataaattatttcagtttttgtctttggctatcttgacagctctcattgcc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52767002 |
cacaaaggaattaaagctaaaaccataaagcatcgagtctttctcaagctataaattatttcagtttttgtctttggctatcttaacagctctcattgcc |
52767101 |
T |
 |
| Q |
114 |
cccaaagagctaagcgtttagagagttactaattcccaagtattatgcnnnnnnncctaaaaattgaccaaacttgatccttaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
52767102 |
cccaaagagctaagcgtttagagagttactaatgcccaagtattatgcaaaaaaacctaaaaattgaccaaacttgattcttaaatt |
52767188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University