View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18965_high_1 (Length: 596)
Name: NF18965_high_1
Description: NF18965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18965_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 6e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 6e-94
Query Start/End: Original strand, 392 - 591
Target Start/End: Complemental strand, 51844413 - 51844214
Alignment:
| Q |
392 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
491 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844413 |
cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg |
51844314 |
T |
|
| Q |
492 |
attttaattctaattatagttaaatttacaattggattgaattcattcagannnnnnngctatttttaacatcttctattcgttgaccggctaccttcat |
591 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844313 |
attttaattctaattatagttaaatttacaattggattcaattcattcagatttttttgctatttttaacatcttctattcgttgaccggctaccttcat |
51844214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 3e-74
Query Start/End: Original strand, 3 - 159
Target Start/End: Complemental strand, 51844803 - 51844646
Alignment:
| Q |
3 |
gagaggcctaa-tcagtaagatgaagacttgagacgacattgtcgaaacaaatgacaccaacccatcttgaagaacatggattttgattaggaagccatg |
101 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844803 |
gagaggcctaaatcggtaagatgaagacttgagatgacattgtcgaaacaaatgacaccaacccatcttgaagaacatggattttgattaggaagccatg |
51844704 |
T |
|
| Q |
102 |
atgcaagagattgcgtgtttgtgaaggattgtttgagtttgagaagagcttcagcttc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844703 |
atgcaagagattgcgtgtttgtgaaggattgtttgagtttgagaagagcttcagcttc |
51844646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 222 - 299
Target Start/End: Complemental strand, 51844583 - 51844506
Alignment:
| Q |
222 |
cagcggccattggcaaccgggaatctgaaacgtcctccggttgtttgtagaaatggaccgctgttcggagagatagag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844583 |
cagcggccattggcaaccgggaatctgaaacgtcctccggttgtttgtagaaatggaccgctgttcggagagatagag |
51844506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University