View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18965_high_9 (Length: 320)
Name: NF18965_high_9
Description: NF18965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18965_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 14 - 304
Target Start/End: Original strand, 4098125 - 4098415
Alignment:
| Q |
14 |
agattgattgttacaaattggttcactttatatataccctttatacaatagcattcattttaattttagagggtgctaaactattttttgtttgaatgtc |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098125 |
agattaattgttacaaattggttcactttttatataccctttatacaatagcattcattttaattttagagggtgctaaactattttttgtttgaatgtc |
4098224 |
T |
|
| Q |
114 |
tttaaatctattgctataaagtgtaaaaatttatgtaatggatattgttagctggtgaacattcagagtgaactcttaagatagaaagctactaagttga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098225 |
tttaaatctattgctataaagtgtaaaaatttatgtaatggatattgttagctggtgaacattcagagtgaactcttaagatagaaagctactaagttga |
4098324 |
T |
|
| Q |
214 |
actggtgagaaaagatcaatggttgatgaccgaaaataatggcagcaacgatagagatggtcattgtatattcgtaaacactccaacaatt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098325 |
actggtgagaaaagatcaatggttgatgaccgaaaataatggcagcaacgatagagatggtcattgtatattcgtaaacactccaacaatt |
4098415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University