View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18965_low_11 (Length: 307)
Name: NF18965_low_11
Description: NF18965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18965_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 34144507 - 34144236
Alignment:
| Q |
1 |
tctgataaaagaaagaggaaaaagagaagcagatgcagcagtggctcacttgatgcagggggaacaccaaatagcgtagaagttgtttcagaaaatggta |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34144507 |
tctgacaaaagaaagaggaaaaagagaagtagatgcagcagtggctcacttgatgcaggaggaacaccaaatagcgtagaagttgtttcagaaaatgtta |
34144408 |
T |
|
| Q |
101 |
atgtggatagaagcgtcaaatgtccgcgcacatcagaagacacatcttacataagaaatcatgtatatctaaatgatgctgccatttttaacaatgatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34144407 |
atgtggatagaagcgtcaaatgtccgcgcacatcagaagacacatcatacataagaaaccatgtatatctaaatgatgctgccatttttaacaatgatcc |
34144308 |
T |
|
| Q |
201 |
tatgtttgaagaagtattgggctcaggggatacctcatacgcttctaaatttggattgtgggatagaaaaga |
272 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34144307 |
tatgtttgaagaagtgttgggctcaggggatacctcatacgcttctaaatttggattgttggatagaaaaga |
34144236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University