View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18965_low_19 (Length: 240)
Name: NF18965_low_19
Description: NF18965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18965_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 11757992 - 11757796
Alignment:
| Q |
15 |
tcaaatctacgaacacattcaacaccactcgaaatttcacttctcgagttcgttcttcctttaacagcagagattctactcgaatcacacgaaacttcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11757992 |
tcaaatctacgaacacattcaacaccactcgaaatttcacttctcgagttcgttcttcctttaacagcagagattctactcgaatcacacgaaacttcac |
11757893 |
T |
 |
| Q |
115 |
ctccggcgaaatccgaaccagaactcgaactcgaatcaactgaaccaacagaaaaaccgagattctcacgagaagctttgaatctcggagaaacaagtag |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11757892 |
ctccggcgaaatccgaaccagaact------cgaatcaactgaaccaacagaaaaaccgcgattctcacgagaagctttgaatctcggagaaacaagtag |
11757799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University