View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18965_low_20 (Length: 234)
Name: NF18965_low_20
Description: NF18965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18965_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 4 - 220
Target Start/End: Original strand, 51937871 - 51938087
Alignment:
| Q |
4 |
ttttgttactcttaagtattatactccctctgacccaaatcaagtgtgtagttggtatttcagacaaagtattttacaagtaaatcttattgatgattgg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937871 |
ttttgttactcttaagtattatactccctctgacccaaatcaagtgtgtagttggtatttcagacaaagtattttacaagtaaatcttattgatgattgg |
51937970 |
T |
 |
| Q |
104 |
tatattgaccattatcataaatgttaaagtagtagtaaggtgtaaggtttggattaaaaatagaagaaaaatgaatgattagtaaaagaaactaaattac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937971 |
tatattgaccattatcataaatgttaaagtagtagtaaggtgtaaagtttggattaaaaatagaagaaaaatgaatgattagtaaaagaaactaaattac |
51938070 |
T |
 |
| Q |
204 |
aacaatatatatcaacc |
220 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
51938071 |
aactatatatatcaacc |
51938087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University