View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18967_high_4 (Length: 216)
Name: NF18967_high_4
Description: NF18967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18967_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 6915848 - 6915996
Alignment:
| Q |
18 |
cagagagtgggcaaacaatcatttctggaatgggagaactacacttagatatttatgttaaatgcattaagatggagtatggggttgatgctacagttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915848 |
cagagagtgggcaaacaatcatttctggaatgggagaactacacttagatatttatgttaaacgcattaagatggagtatggggttgatgctacagttgg |
6915947 |
T |
 |
| Q |
118 |
aaagccccgggtaaacttcagagaaactgttactcaacgtgctgatttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915948 |
aaagccccgggtaaacttcagagaaactgttactcaacgtgctgatttt |
6915996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 100 - 166
Target Start/End: Complemental strand, 15039391 - 15039325
Alignment:
| Q |
100 |
ggttgatgctacagttggaaagccccgggtaaacttcagagaaactgttactcaacgtgctgatttt |
166 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15039391 |
ggttgatgctacagttggaaagccccgtgtaaacttcagagaaactgttactcaacgtgctgatttt |
15039325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 86
Target Start/End: Complemental strand, 15039977 - 15039923
Alignment:
| Q |
32 |
acaatcatttctggaatgggagaactacacttagatatttatgttaaatgcatta |
86 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||||| || |||||| |
|
|
| T |
15039977 |
acaattatttctggaatgggagaactgcacttagatatctatgttgaacgcatta |
15039923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University