View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18967_low_4 (Length: 279)
Name: NF18967_low_4
Description: NF18967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18967_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 268
Target Start/End: Complemental strand, 31480824 - 31480565
Alignment:
| Q |
9 |
gataagaactagagaagatgttgttgctatttttgtaagcattgcatttaggccttgacttttatcccacaaaattcattcaaatttactttaaaatatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31480824 |
gataagaactagagaagatgttgttgctgtttttgtaagcattgcatttaggccttgactttcatcccacaaaactcattcaaatttactttaaaatatc |
31480725 |
T |
|
| Q |
109 |
cctacggtccttgatgaaattttcctatttggtcgggacttttatcatcgagtgattggtttggtttcacaatacaaaccaatataattggttcattttt |
208 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31480724 |
cctacggtccttgataaaattttccaatttggtcgggacttttatcatcgagtgattggtttggtttgacaatacaaaccaatataattggttcattttt |
31480625 |
T |
|
| Q |
209 |
cccatattaggatccaaaccaatcaaatccaacctctattggtccgagcatcagtttcat |
268 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31480624 |
cccatattaggatccaaactaatcaaatccgacctctattggtccgagcatcagtttcat |
31480565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University