View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18968_low_3 (Length: 274)
Name: NF18968_low_3
Description: NF18968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18968_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 13887968 - 13888037
Alignment:
| Q |
18 |
atcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgtga |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13887968 |
atcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgcaatggatgcgtga |
13888037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 258
Target Start/End: Original strand, 13888135 - 13888211
Alignment:
| Q |
182 |
gtgttgattcctgaatcttccattcnnnnnnnattcttcaccgatcaaatgatggtacataatcaagatccaacaca |
258 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
13888135 |
gtgttgattcctgaatcttccattctttttttattcttcaccgatcaaatgatggtgcgtaatcaagatccaacaca |
13888211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 11021592 - 11021525
Alignment:
| Q |
18 |
atcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgt |
85 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
11021592 |
atcagaagtcttctcttgagagaaggttgttacgattcagttacgcttctcttccgccatggatgcgt |
11021525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 15095019 - 15095084
Alignment:
| Q |
22 |
gaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgtga |
87 |
Q |
| |
|
||||||||||||| | |||||||||| |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
15095019 |
gaagccttctcttggtagaaggtggtcacgattcagttacgcatcatttccgcaatggatgcgtga |
15095084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University