View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1896_high_16 (Length: 301)
Name: NF1896_high_16
Description: NF1896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1896_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 65 - 295
Target Start/End: Complemental strand, 22811822 - 22811591
Alignment:
| Q |
65 |
tttgaaataaaacaatgatggttaaaatattcatatcttaaattccatatttatctctatttaatccacaaactcaaaaattat--tcaagccaaacaaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
22811822 |
tttgaaataaaacaatgatggttaaa-tattcatatcttcaactccatatttatctctatttaatccacaaactcaacaattatattcaaggcaaacaaa |
22811724 |
T |
 |
| Q |
163 |
atagaaatctcatccctctccacctctgaagcatagatacttcaaaatggatgttgtaccgatatctatactcaaaagataatttagtaataattacaca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22811723 |
atagaaatctcatccctctccacctctgaagcatagatacttcaaaatggatgttgtaccggtatctatactcaaaagataatttagtaataattacaca |
22811624 |
T |
 |
| Q |
263 |
tgaaatgtagaaagacgatatttcctatgctac |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22811623 |
tgaaatgtagaaagacgatatttcctatgctac |
22811591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University