View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1896_low_14 (Length: 339)
Name: NF1896_low_14
Description: NF1896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1896_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 12 - 322
Target Start/End: Complemental strand, 44459578 - 44459268
Alignment:
| Q |
12 |
acagaagggcttgattctcttggtaggccaaacaatgagtaacttgtgatgaaatttagaatttgtgataacattatagtttgattttgctttcatagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44459578 |
acagaagggcttgattctcttggtaggccaaacaatgagtaacttgtgatgaaatttagaatttgtgataacattatagtttgattttgctttcatagaa |
44459479 |
T |
 |
| Q |
112 |
ataggaaaactacaaaaggtgcaaaggattgtatatggagattgttgattttagtaagtttatttcaagagttaagttaagtggtaagggggaggattct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44459478 |
ataggaaaactacaaaaggtgcaaaggattgtatatggagattgttgattttagtaagtttatttcaagagttaagttaagtggtaagggggaggattct |
44459379 |
T |
 |
| Q |
212 |
tgtacttaaaaaaccatgtgaaatattatttgcttttcccccttttagtttttatcttgagattttgctttgtataatcaatctcctctttaacttgctg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44459378 |
tgtacttaaaaaaccatgtgaaatattatttgcttttcccccctttagtttttatcttgagattttgctttgtataatcaatctcctctttaacttgctg |
44459279 |
T |
 |
| Q |
312 |
catcctcattg |
322 |
Q |
| |
|
||||||||||| |
|
|
| T |
44459278 |
catcctcattg |
44459268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University