View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1896_low_22 (Length: 242)
Name: NF1896_low_22
Description: NF1896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1896_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 88 - 225
Target Start/End: Complemental strand, 47620216 - 47620080
Alignment:
| Q |
88 |
ttggaggagcatcgggtgtgtatatatgaaccaatgttttaaaaccataagagaggtataggtatacttcacatctctataaaaaatccgaagaaattag |
187 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47620216 |
ttggaggagcatcgg-tgtatatgtatgaaccgatgttttagaaccataagagaggtataggtatacttcacatctctataaaaaatccaaagaaattag |
47620118 |
T |
 |
| Q |
188 |
atttatgagtcaacctctcttatagcatatacataatt |
225 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
47620117 |
atttatgaatcaacctctcttataacatatacataatt |
47620080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University