View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1896_low_23 (Length: 240)
Name: NF1896_low_23
Description: NF1896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1896_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 34 - 108
Target Start/End: Complemental strand, 44920144 - 44920070
Alignment:
| Q |
34 |
tccatgttaatgtcattagagtgcttgaccatacaaatactctatattactagagtattaatatattaaatataa |
108 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44920144 |
tccatgttaatgtcattggagtgtttgaccatacaaatactctatattactagagtattaatatattaaatataa |
44920070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 223
Target Start/End: Complemental strand, 44920002 - 44919964
Alignment:
| Q |
185 |
ggggttctcttggctatcccatatctatatcacccatct |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44920002 |
ggggttctcttggctatctcatatctatatcacccatct |
44919964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University