View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18973_low_7 (Length: 240)
Name: NF18973_low_7
Description: NF18973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18973_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 224
Target Start/End: Original strand, 34264401 - 34264612
Alignment:
| Q |
13 |
aatattgggaaacatcttcttaattatcttcactaggatatgctatatagccttgtacctattgaattgatcaaggactatgttataggcttaattagga |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34264401 |
aatattgggaaacatcatcttaattatcttcactaggatatgctatatagccttgtacctattgaattgatcaaggactatgttataggcttaattaaga |
34264500 |
T |
|
| Q |
113 |
aattttaatttagtcccctagcacgctttcaaagtggtatggaattagatgcattagtaatggtacatatactcactcatagagaagagaatcattgtat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34264501 |
aattttaatttagtcccctagcacgctttcaaagtggtatggaattagatgcattagtaatggtacatatactcactcatagagaagagaatcattgtat |
34264600 |
T |
|
| Q |
213 |
atatgtgcttga |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34264601 |
atatgtgcttga |
34264612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University