View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_high_115 (Length: 230)
Name: NF18974_high_115
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_high_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 44532962 - 44532750
Alignment:
| Q |
1 |
gggtttgtggatggaacagtggttgtgacatatgatattgctcgtgtggtttcaatgggatttgttgttggtgtgttattatttgtttgtggttttggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44532962 |
gggtttgtggatggaacagtggttgtgacatatgatattgcttgtgtggtttcaatgggatttgttgttggtgtgttattatttgtttgtggttttggat |
44532863 |
T |
 |
| Q |
101 |
ggtaagaggagaatgtgagttgtttttcaagtgcttgtaattgatcaaaaaatctataggtttttccttctgatttcccacttctaccttctttggttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44532862 |
ggtaagaggagaatgtgagttgtttttcaagtgcttgtaattgatcaaaaaatctataggtttttccttctgatttcccacttctaccttctttggttct |
44532763 |
T |
 |
| Q |
201 |
tttgtgatacttg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44532762 |
tttgtgatacttg |
44532750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 44554487 - 44554572
Alignment:
| Q |
127 |
tcaagtgcttgtaattgatcaaaaaatctataggtttttccttctgatttcccacttctaccttctttggttcttttgtgatactt |
212 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||| || || || |||||||| |||| || ||| ||||||||||| ||||||||||| |
|
|
| T |
44554487 |
tcaagggcttctaattgatcaaaaaatcgataagtcttaccatctgattttccacctcgaccatctttggttctcttgtgatactt |
44554572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 124 - 209
Target Start/End: Complemental strand, 12682193 - 12682108
Alignment:
| Q |
124 |
ttttcaagtgcttgtaattgatcaaaaaatctataggtttttccttctgatttcccacttctaccttctttggttcttttgtgata |
209 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| ||||| || |||||||| |||| ||| |||||||||||||| |||||||| |
|
|
| T |
12682193 |
ttttcaagggcttgtaattgatcaaagaatctataagttttaccatctgatttaccacctcttccttctttggttctcttgtgata |
12682108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University