View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18974_high_123 (Length: 214)

Name: NF18974_high_123
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18974_high_123
NF18974_high_123
[»] chr8 (2 HSPs)
chr8 (18-214)||(13023610-13023806)
chr8 (18-127)||(13070203-13070312)
[»] chr1 (2 HSPs)
chr1 (21-109)||(46160205-46160293)
chr1 (21-73)||(46167067-46167119)


Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 13023610 - 13023806
Alignment:
18 gatgatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggttagtagaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13023610 gatgatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggttagtagaa 13023709  T
118 tttttctatatggacatctagcttttgtttattctctataatatatttaggtaaatgatcattataggcgggtgtttgttgattttcctacaatgat 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
13023710 tttttctatatggacatctagcttttgtttattctctataatatatttaggtaaatgatcattataggcgggtgtttgttgattttccaacaatgat 13023806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 13070312 - 13070203
Alignment:
18 gatgatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggttagtagaa 117  Q
    ||||||||||||||||||||||||| ||||||||| ||||||||||| | ||||||| ||||   ||||||||||||||| |||||||||||||||||||    
13070312 gatgatgcagaggaatttagacctgcaagatggctggatgaaaatggcaattttcaggcagagaaccctttcaagtttactgcttttcaggttagtagaa 13070213  T
118 tttttctata 127  Q
    ||||||||||    
13070212 tttttctata 13070203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 46160205 - 46160293
Alignment:
21 gatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggt 109  Q
    ||||| ||| |||| ||||| || |||||||||||||||||||||| |||||||  |||| ||||||| ||||| || || ||||||||    
46160205 gatgctgagcaattcagaccagagagatggcttgatgaaaatggaaattttcagagagaaagcccttttaagttcacagcctttcaggt 46160293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 46167067 - 46167119
Alignment:
21 gatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttca 73  Q
    ||||| ||| |||| ||||| || |||||||||||||||||||||| ||||||    
46167067 gatgctgagcaattcagaccagagagatggcttgatgaaaatggaaattttca 46167119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University