View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_high_31 (Length: 445)
Name: NF18974_high_31
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 365
Target Start/End: Complemental strand, 2465282 - 2464924
Alignment:
| Q |
1 |
agtaagtcgagcgcggctgtgacagaggcataacatgatcttaaaaacatgaaaatggggttagttctgcttgtggacggcagctctaactaaaatgccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2465282 |
agtaagtcgagcgcggctgtgacagaggcataacatgatcttaaaaacatgaaaatgagcttaattctgcttgaggacggcagctctaactccaatgcca |
2465183 |
T |
|
| Q |
101 |
catctccaatggatggtttaaacttgaagatatcattgtagcagagcaagcttgttagttgtgtccagacctggcgacagcctttatttgagtggtagtg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2465182 |
catctccaatgggtggtttaaacttgaagatatcattgtagcagggcaagcttgttagttgtgtccagacctggcgacagcctttatttgagtg-----g |
2465088 |
T |
|
| Q |
201 |
ttttagtgccactctagagtgtaaaaattttctccattgatttcttctgttataaacacaacatctcaaacatcgttaaatgccctttttcacaatcttt |
300 |
Q |
| |
|
|||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
2465087 |
ttttagtggcactctggagtgtaaaaaatttctccattgatttcttctgttataaacacaacatctcaaacatcgttaaatgccc-ttttcacagtcttt |
2464989 |
T |
|
| Q |
301 |
gtttattcttagtctgggcgtggtatgtagtggacttccctagtttcataccacttcagcataac |
365 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2464988 |
gtttattcttagtctgggcgtggtatgtggtggacttccctagtttcataccacttcagcataac |
2464924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 373 - 435
Target Start/End: Complemental strand, 2463283 - 2463221
Alignment:
| Q |
373 |
tggtatggttcaagatttgaggccaacattataaattttttgaaccaatgaatttgagaatta |
435 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2463283 |
tggtatggttcaagatttgaggccaacattataaattttttgaaccaatgaatttgagaatta |
2463221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University