View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_high_65 (Length: 340)
Name: NF18974_high_65
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_high_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 34502407 - 34502655
Alignment:
| Q |
15 |
catagggattacaataaaagcacaatgcaagcaataagatcacaattaattaatcata----------gtaaaggaggcgtctgagaaaatcccttacaa |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34502407 |
cataaggattacaataaaagcacaatgcaagcaataagatcacaattaattaatcatacatcattagggtaaaggaggcgtctgagaaaatcccttacaa |
34502506 |
T |
 |
| Q |
105 |
cgccttgaaagattgcaacaggatcttttctcggaaggcgttcagaggcggtagcggttgttgtttcagttgttttctgttcggaaatgtcgtcggtctc |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34502507 |
cgccttgaaagattgcaacaggttcttttctcggaaggcgttcagaggcggtagcggttgttgtttcagttgttttctgttcggaaatgtcgtcggtctc |
34502606 |
T |
 |
| Q |
205 |
gagaggcggtggtggtggctgaaatggaacggggctgaacaccaatccc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34502607 |
gagaggcggtggtggtggctgaaatggaacggggctgaacaccaatccc |
34502655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University