View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_high_7 (Length: 673)
Name: NF18974_high_7
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 454 - 655
Target Start/End: Original strand, 1253574 - 1253779
Alignment:
| Q |
454 |
aacataatgagaatttagcaggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattcacctaaggatagaaacatataattc |
553 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253574 |
aacataatgagaatttagcgggatgttacactctatcccactaaagaaaatttcgttctcgaaatttagaaattcacctaaggatagaaacatataattc |
1253673 |
T |
|
| Q |
554 |
ctctacacttccagccttggtttccaacacgcgttctctactat----ctgtctcgatccaactgacttatcgggtttctatcgttacacgaggatctga |
649 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
1253674 |
ctctacactttcagccttggtttccaacacgcgttctctactatccgactctctcgatccaactgacttatcgggtttctatcattagacgaggatctga |
1253773 |
T |
|
| Q |
650 |
caacat |
655 |
Q |
| |
|
|||||| |
|
|
| T |
1253774 |
caacat |
1253779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 474 - 528
Target Start/End: Complemental strand, 2441 - 2387
Alignment:
| Q |
474 |
ggatgttacactctatccccctaaagaaaatttcgtcctcgaaatttagaaattc |
528 |
Q |
| |
|
|||| |||||||||| |||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
2441 |
ggatattacactctaccccccttaaagaaatttcgtcctcgaaatttagagattc |
2387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University