View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_high_83 (Length: 291)
Name: NF18974_high_83
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_high_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 45594421 - 45594146
Alignment:
| Q |
1 |
ctgataggtttcttccttccgccgttgctactcccaattcttcatcttcttcacttctcagtgacgaagcatttaaaggattaggctctagtttcgacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594421 |
ctgataggtttcttccttccgccgttgctactcccaattcttcatcttcttcacttctcagtgacgaagcatttaaaggattaggctctagtttcgacgg |
45594322 |
T |
|
| Q |
101 |
agaatctgaagatgaagattttccgtcacgaactacttctattaacgctgatgaacttgacatttctaaactcgatttgccttcgcagcttgttgattcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594321 |
agaatctgaagatgaagattttccgtcacgaactacttctattaacgctgatgaacttgacatttctaaactcgatttgccttcgcagcttgttgattcg |
45594222 |
T |
|
| Q |
201 |
ctacgtgaccgtgggattactcaactttttcctattcaggttcgttaacaaaacctagcatgttaatttgaatgat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594221 |
ctacgtgaccgtgggattactcaactttttcctattcaggttcgttaacaaaacctagcatgttaatttgaatgat |
45594146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University