View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_101 (Length: 253)
Name: NF18974_low_101
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_101 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 3339843 - 3339595
Alignment:
| Q |
1 |
aacaattttaaataggcttaaag-cgaattttggtttaccttcattttgtattcatgagnnnnnnngacatattagtttggtaataaaatgaatctcata |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
3339843 |
aacaattttaaataggcttaaaggcgaattttggtttaccttcattttgtattcatgagaaaaaaagacatat-agtttggtgataaaatgaatctcata |
3339745 |
T |
 |
| Q |
100 |
aagctatcagatgtgtatatctctctcgtagacaataaatagagtacggataataatacttgacacgacaaaataagtgcatgactcatagcacgacata |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3339744 |
aagctatcacatgtgtatatctctctcgtagacaataaatagagtaaggttaatgatagttgacacgacaaaataagtgcatgactcatagcacgacata |
3339645 |
T |
 |
| Q |
200 |
tttaaaaccgttggatgattgtttgttgttttataccattcttctctctc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
3339644 |
tttaaaaccgttggatgattgtttgttgttttataccattgttttctctc |
3339595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University