View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_109 (Length: 248)
Name: NF18974_low_109
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_109 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 108 - 245
Target Start/End: Complemental strand, 3340083 - 3339946
Alignment:
| Q |
108 |
cttgatcaaataaatgaaatcaacatagttgttaattgatttttgagtgaatcaccaaatttattctttgcaattgtaggaaattgttaacttgttttta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3340083 |
cttgatcaaataaatgaaatcaacatagttgttaattgatttttgagtgaatcaccaaatttattctttgcaattgtaggaaattgttaacttgttttta |
3339984 |
T |
|
| Q |
208 |
aactatgtttcaaattctcttttaattttaaaattctc |
245 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3339983 |
aactatgtttaaaattctcttttaattttaaaattctc |
3339946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 3340168 - 3340103
Alignment:
| Q |
18 |
catccaggacctgtaacaaaaaagcacattgttaccttattagtagagaacgtatatcggagaaat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3340168 |
catccaggacctgtaacaaaaaagcacattgttaccttattagtagagaacgtatatcagagaaat |
3340103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University