View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_112 (Length: 244)
Name: NF18974_low_112
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 2465301 - 2465532
Alignment:
| Q |
1 |
tagatattttactgcatattcctgcctaaactaaaatataatcatccagaagctttcctta----tatgacaactgtactttctgttatgattaatcaag |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2465301 |
tagatattttactgcatattcctgcctaaactaaaatataatcatccagaagctttccttaattatatgacaactgtactttctgttatgattaatcaag |
2465400 |
T |
 |
| Q |
97 |
agtttgttagaagaggttgttagaatcatatttggattgcagattttcccgagatgagctctttccaatttccagtgagagagtgaatggaaacgtaact |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2465401 |
agtttgttagaagaggttgttagaatcatatttggattgtagatttttccgagatgacctctttccaatttccagtgagagagtgaatggaaacgtaact |
2465500 |
T |
 |
| Q |
197 |
tacgagagcgaggaacagtagatggcgaaaac |
228 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
2465501 |
tacgagagcgatgaacagtagatggcgaaaac |
2465532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University