View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_127 (Length: 216)
Name: NF18974_low_127
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_127 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 47088673 - 47088877
Alignment:
| Q |
1 |
accagactatattaacattggtagctttcccttccctatggatgatatgttgattgttgatgactggccaggagattatattagtttttgcttccttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47088673 |
accagactatattaacattggtagttttcccttccctatggatgatatgttgattgttgatgactggccaggagattatattagtctttgcttccttgat |
47088772 |
T |
 |
| Q |
101 |
ctgtcatgaataaaactatttttatagctgaatctcgtatgctttgctaaaactagtgacaattttcaatttatacactagatattcactgatatttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47088773 |
ctgtcatgaataaaactatttttatagctgaatctcgtatgctttgctaaaactagtgacaattttcaatttatacactagatactcactgatatttcat |
47088872 |
T |
 |
| Q |
201 |
catat |
205 |
Q |
| |
|
||||| |
|
|
| T |
47088873 |
catat |
47088877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University