View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18974_low_128 (Length: 214)

Name: NF18974_low_128
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18974_low_128
NF18974_low_128
[»] chr3 (1 HSPs)
chr3 (73-179)||(46230572-46230678)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 73 - 179
Target Start/End: Original strand, 46230572 - 46230678
Alignment:
73 catgtgaaatgtcgtctttattagtgtgattgtgatcgttaattagcacaaagaggtaacgatcattttgattatccaattggattgctgaaataacttt 172  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
46230572 catgtgaaatgtcttctttattagtgtgattgtgatcgttaattagcacaaaggcgtaacgatcattttgattatccaattggattgctgaaataacttt 46230671  T
173 tgctgta 179  Q
    |||||||    
46230672 tgctgta 46230678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University