View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_128 (Length: 214)
Name: NF18974_low_128
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 73 - 179
Target Start/End: Original strand, 46230572 - 46230678
Alignment:
| Q |
73 |
catgtgaaatgtcgtctttattagtgtgattgtgatcgttaattagcacaaagaggtaacgatcattttgattatccaattggattgctgaaataacttt |
172 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46230572 |
catgtgaaatgtcttctttattagtgtgattgtgatcgttaattagcacaaaggcgtaacgatcattttgattatccaattggattgctgaaataacttt |
46230671 |
T |
 |
| Q |
173 |
tgctgta |
179 |
Q |
| |
|
||||||| |
|
|
| T |
46230672 |
tgctgta |
46230678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University